Transcript: Human XM_017013009.2

PREDICTED: Homo sapiens CUB and Sushi multiple domains 3 (CSMD3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CSMD3 (114788)
Length:
12859
CDS:
107..11020

Additional Resources:

NCBI RefSeq record:
XM_017013009.2
NBCI Gene record:
CSMD3 (114788)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013009.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435708 GATCCTGGTACACCCTTATAT pLKO_005 2102 CDS 100% 15.000 21.000 N CSMD3 n/a
2 TRCN0000423573 TTCACGGAGTCAGTCGTAATT pLKO_005 6690 CDS 100% 13.200 18.480 N CSMD3 n/a
3 TRCN0000146954 CCAATGAATTACGGCTAGATT pLKO.1 7269 CDS 100% 5.625 7.875 N CSMD3 n/a
4 TRCN0000419650 CAGACTTGGAATGGATTATAA pLKO_005 5239 CDS 100% 15.000 12.000 N CSMD3 n/a
5 TRCN0000147140 CCATAGCAATTAGGTGTGAAA pLKO.1 5634 CDS 100% 4.950 3.960 N CSMD3 n/a
6 TRCN0000421892 GGTGCATCTGCAACGAATAAT pLKO_005 3830 CDS 100% 15.000 10.500 N CSMD3 n/a
7 TRCN0000087306 GCAGAAGAACGAAATAGAATA pLKO.1 395 CDS 100% 13.200 9.240 N LOC432952 n/a
8 TRCN0000150302 CCACCAATTATCAGCAACAAA pLKO.1 1046 CDS 100% 5.625 3.938 N CSMD3 n/a
9 TRCN0000147435 GCACATTTAGTTCACTGCTAA pLKO.1 11073 3UTR 100% 4.950 3.465 N CSMD3 n/a
10 TRCN0000087305 GCTACAGCTGTGTAACTGGAT pLKO.1 708 CDS 100% 2.640 1.848 N LOC432952 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013009.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.