Transcript: Human XM_017013047.1

PREDICTED: Homo sapiens unc-5 netrin receptor D (UNC5D), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UNC5D (137970)
Length:
9055
CDS:
303..3068

Additional Resources:

NCBI RefSeq record:
XM_017013047.1
NBCI Gene record:
UNC5D (137970)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419223 ATATAAGAGGGCTCTACTATC pLKO_005 3262 3UTR 100% 10.800 15.120 N UNC5D n/a
2 TRCN0000061318 CGCGAAGTGTTCATCAATGTT pLKO.1 636 CDS 100% 5.625 7.875 N UNC5D n/a
3 TRCN0000438007 ACTATGGCGTGGACGTCATTG pLKO_005 1360 CDS 100% 10.800 7.560 N UNC5D n/a
4 TRCN0000061322 CACACGAAACTCTCAAACATT pLKO.1 2991 CDS 100% 5.625 3.938 N UNC5D n/a
5 TRCN0000061319 CCTCTGGAGAATTAAACCATT pLKO.1 2486 CDS 100% 4.950 3.465 N UNC5D n/a
6 TRCN0000061320 GCAAATTCTGTGAAGGTCTAA pLKO.1 1156 CDS 100% 4.950 3.465 N UNC5D n/a
7 TRCN0000061321 CGCATAGCCTATTTACGGAAA pLKO.1 759 CDS 100% 4.050 2.835 N UNC5D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.