Transcript: Human XM_017013136.1

PREDICTED: Homo sapiens glutamate rich 1 (ERICH1), transcript variant X29, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ERICH1 (157697)
Length:
7674
CDS:
2313..3335

Additional Resources:

NCBI RefSeq record:
XM_017013136.1
NBCI Gene record:
ERICH1 (157697)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172285 CCAGAAACATGCTGAGCCTTT pLKO.1 1766 5UTR 100% 4.050 5.670 N ERICH1 n/a
2 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 5529 3UTR 100% 4.950 2.475 Y ORAI2 n/a
3 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 4568 3UTR 100% 4.050 2.025 Y LOC441087 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.