Transcript: Human XM_017013265.1

PREDICTED: Homo sapiens pleckstrin and Sec7 domain containing 3 (PSD3), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PSD3 (23362)
Length:
10497
CDS:
522..2057

Additional Resources:

NCBI RefSeq record:
XM_017013265.1
NBCI Gene record:
PSD3 (23362)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431630 CGTATTGGAAGTACTACTAAC pLKO_005 1209 CDS 100% 10.800 8.640 N PSD3 n/a
2 TRCN0000123164 CGCCTTTATATGTGAAATCTT pLKO.1 2486 3UTR 100% 5.625 4.500 N PSD3 n/a
3 TRCN0000123168 CTGTGCAATAATGCTTCTTAA pLKO.1 956 CDS 100% 13.200 9.240 N PSD3 n/a
4 TRCN0000295661 TTTCTGGTAATCCGTGAATAT pLKO_005 2115 3UTR 100% 13.200 9.240 N Psd3 n/a
5 TRCN0000123167 CCTGTGCAATAATGCTTCTTA pLKO.1 955 CDS 100% 5.625 3.938 N PSD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.