Transcript: Human XM_017013361.2

PREDICTED: Homo sapiens sodium/potassium transporting ATPase interacting 3 (NKAIN3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NKAIN3 (286183)
Length:
2400
CDS:
1701..2171

Additional Resources:

NCBI RefSeq record:
XM_017013361.2
NBCI Gene record:
NKAIN3 (286183)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013361.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134058 CCTCGATACATAATGGTGTAT pLKO.1 1689 5UTR 100% 0.495 0.693 N NKAIN3 n/a
2 TRCN0000414173 CTCAAAGGACACCGATCTAAT pLKO_005 1781 CDS 100% 13.200 9.240 N NKAIN3 n/a
3 TRCN0000134734 GCCTGTTATGTGATCAGTATT pLKO.1 2004 CDS 100% 13.200 9.240 N NKAIN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013361.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.