Transcript: Human XM_017013468.1

PREDICTED: Homo sapiens ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 (ASAP1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASAP1 (50807)
Length:
6315
CDS:
467..3688

Additional Resources:

NCBI RefSeq record:
XM_017013468.1
NBCI Gene record:
ASAP1 (50807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293956 TGATAAGTTTGGGAGTAATTT pLKO_005 586 CDS 100% 15.000 21.000 N ASAP1 n/a
2 TRCN0000123116 CCTCTTCAAGTAAGACTACAA pLKO.1 2889 CDS 100% 4.950 6.930 N ASAP1 n/a
3 TRCN0000123117 GCCATCAAATCCAGGGATTTA pLKO.1 2006 CDS 100% 1.320 1.848 N ASAP1 n/a
4 TRCN0000293926 TTCGTCGAGAGATTCACTATG pLKO_005 449 5UTR 100% 10.800 8.640 N ASAP1 n/a
5 TRCN0000293924 TTGACTCTGTTCCTAACAATG pLKO_005 4041 3UTR 100% 10.800 7.560 N ASAP1 n/a
6 TRCN0000123118 GCCAAGAATGTAGGAAACAAT pLKO.1 1817 CDS 100% 5.625 3.938 N ASAP1 n/a
7 TRCN0000298244 GCCAAGAATGTAGGAAACAAT pLKO_005 1817 CDS 100% 5.625 3.938 N ASAP1 n/a
8 TRCN0000123115 CCAGGGATTTACTTGCACTAA pLKO.1 2016 CDS 100% 4.950 3.465 N ASAP1 n/a
9 TRCN0000286562 CCAGGGATTTACTTGCACTAA pLKO_005 2016 CDS 100% 4.950 3.465 N ASAP1 n/a
10 TRCN0000123114 GCCATGTTTATCAGATCCTTA pLKO.1 4990 3UTR 100% 4.950 3.465 N ASAP1 n/a
11 TRCN0000093433 CCATTTGACAAAGCCTGGAAA pLKO.1 782 CDS 100% 4.950 2.970 N Asap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.