Transcript: Human XM_017013754.1

PREDICTED: Homo sapiens sperm associated antigen 1 (SPAG1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPAG1 (6674)
Length:
3783
CDS:
16..2901

Additional Resources:

NCBI RefSeq record:
XM_017013754.1
NBCI Gene record:
SPAG1 (6674)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155114 GCGTCGTGCTACTACATATAA pLKO.1 960 CDS 100% 15.000 21.000 N SPAG1 n/a
2 TRCN0000431537 CAGATGATCTAAGTATCTTAT pLKO_005 1568 CDS 100% 13.200 18.480 N SPAG1 n/a
3 TRCN0000157399 GACCCTGAGAAACTTCCGATA pLKO.1 2500 CDS 100% 4.050 5.670 N SPAG1 n/a
4 TRCN0000155149 GCCTATAACAATCGAGCTCAA pLKO.1 850 CDS 100% 4.050 5.670 N SPAG1 n/a
5 TRCN0000155449 GCTATGAAGGAGTCCTCTTAA pLKO.1 3213 3UTR 100% 13.200 9.240 N SPAG1 n/a
6 TRCN0000155860 CCTGTGGATTACAGTCAGTTA pLKO.1 3351 3UTR 100% 4.950 3.465 N SPAG1 n/a
7 TRCN0000413459 TGTGGACTCCAGCTAGCAAAT pLKO_005 1774 CDS 100% 10.800 6.480 N SPAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.