Transcript: Human XM_017013794.1

PREDICTED: Homo sapiens thyroglobulin (TG), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TG (7038)
Length:
8338
CDS:
59..8230

Additional Resources:

NCBI RefSeq record:
XM_017013794.1
NBCI Gene record:
TG (7038)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013794.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073724 CCTTATGAGTTCTCACGGAAA pLKO.1 7934 CDS 100% 4.050 5.670 N TG n/a
2 TRCN0000222546 CCGGAAACTTCAGTCTCTTTA pLKO.1 2499 CDS 100% 13.200 10.560 N TG n/a
3 TRCN0000433442 GCTAAGAAGGATGGTACTATG pLKO_005 1670 CDS 100% 10.800 7.560 N TG n/a
4 TRCN0000431789 TGTACCTTCTGTGCCCATTTC pLKO_005 6649 CDS 100% 10.800 7.560 N TG n/a
5 TRCN0000073725 CCACTCTCTGTGGGATTAGAT pLKO.1 1619 CDS 100% 5.625 3.938 N TG n/a
6 TRCN0000073723 GCACTGGCTTTGGATTTCTAA pLKO.1 6075 CDS 100% 5.625 3.938 N TG n/a
7 TRCN0000437360 GAGAGCCACCAGGTGATATTG pLKO_005 5411 CDS 100% 13.200 7.920 N TG n/a
8 TRCN0000073726 CCTGCCTAGAAACAGGAGAAT pLKO.1 3378 CDS 100% 4.950 3.465 N TG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013794.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.