Transcript: Human XM_017013892.1

PREDICTED: Homo sapiens epiplakin 1 (EPPK1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPPK1 (83481)
Length:
12838
CDS:
6..12170

Additional Resources:

NCBI RefSeq record:
XM_017013892.1
NBCI Gene record:
EPPK1 (83481)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013892.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116988 CGGGAAAGAAACCTACGTGAA pLKO.1 5006 CDS 100% 4.050 5.670 N EPPK1 n/a
2 TRCN0000116991 TCCGTGAAGTATGGACGGTTT pLKO.1 2562 CDS 100% 4.050 5.670 N EPPK1 n/a
3 TRCN0000116990 CCTGCTACAAATCATAAAGAA pLKO.1 5369 CDS 100% 5.625 3.938 N EPPK1 n/a
4 TRCN0000116989 CCAAGGAATTAGACGACAGAT pLKO.1 6626 CDS 100% 4.950 3.465 N EPPK1 n/a
5 TRCN0000116987 GCATACTTGTGTGTCTGGGTT pLKO.1 12216 3UTR 100% 2.640 1.848 N EPPK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013892.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.