Transcript: Human XM_017013949.1

PREDICTED: Homo sapiens exoribonuclease 1 (ERI1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ERI1 (90459)
Length:
5562
CDS:
1049..2257

Additional Resources:

NCBI RefSeq record:
XM_017013949.1
NBCI Gene record:
ERI1 (90459)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435602 TGATTGGAAGGTAGATCTTAT pLKO_005 2664 3UTR 100% 13.200 18.480 N ERI1 n/a
2 TRCN0000433701 TGACTTCAGTGACCCGGTTTA pLKO_005 1384 CDS 100% 10.800 15.120 N ERI1 n/a
3 TRCN0000433229 ACCACCACAAATGCCACATTT pLKO_005 2227 CDS 100% 13.200 9.240 N ERI1 n/a
4 TRCN0000007858 GCATCAGTCTAACTGGAATTA pLKO.1 1764 CDS 100% 13.200 9.240 N ERI1 n/a
5 TRCN0000007856 GCCAAACCAAACTGACAATAA pLKO.1 2025 CDS 100% 13.200 9.240 N ERI1 n/a
6 TRCN0000007855 GCTTGAAACTAGAGGAGTAAA pLKO.1 1483 CDS 100% 13.200 9.240 N ERI1 n/a
7 TRCN0000420127 GTAATTGACTGGATGAAATTG pLKO_005 1835 CDS 100% 13.200 9.240 N ERI1 n/a
8 TRCN0000420352 GTCAACTCAGCAGGCTCAAAT pLKO_005 1935 CDS 100% 13.200 9.240 N ERI1 n/a
9 TRCN0000007857 GCCATTACGAATGGCTGTATT pLKO.1 1415 CDS 100% 1.320 0.924 N ERI1 n/a
10 TRCN0000007854 GCCTTTGGATTTCAAGAATAT pLKO.1 2688 3UTR 100% 13.200 7.920 N ERI1 n/a
11 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 4201 3UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.