Transcript: Human XM_017013969.1

PREDICTED: Homo sapiens PKHD1 like 1 (PKHD1L1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PKHD1L1 (93035)
Length:
15626
CDS:
56..12817

Additional Resources:

NCBI RefSeq record:
XM_017013969.1
NBCI Gene record:
PKHD1L1 (93035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013969.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434651 TAATCTCCCATGGGCTAATAA pLKO_005 4825 CDS 100% 15.000 21.000 N PKHD1L1 n/a
2 TRCN0000149882 GCACCGGATTTAATCCACAAA pLKO.1 6117 CDS 100% 4.950 6.930 N PKHD1L1 n/a
3 TRCN0000148100 GCAACGGTTATGTTGATCTTA pLKO.1 11424 CDS 100% 5.625 4.500 N PKHD1L1 n/a
4 TRCN0000425953 ACCTAAATATGGCAGTATAAA pLKO_005 166 CDS 100% 15.000 10.500 N PKHD1L1 n/a
5 TRCN0000424123 GAATGACCTCTGGTCTATAAA pLKO_005 1771 CDS 100% 15.000 10.500 N PKHD1L1 n/a
6 TRCN0000130197 CCGGACACAGTTCAAGTAATA pLKO.1 1793 CDS 100% 13.200 9.240 N PKHD1L1 n/a
7 TRCN0000433808 GATCTCGTAAGAACGAAATAC pLKO_005 2444 CDS 100% 13.200 9.240 N PKHD1L1 n/a
8 TRCN0000129977 GCCAACTATGACAAACCAATA pLKO.1 2665 CDS 100% 10.800 7.560 N PKHD1L1 n/a
9 TRCN0000148646 CGGCCATTGAATGTGAAACAT pLKO.1 5178 CDS 100% 5.625 3.938 N PKHD1L1 n/a
10 TRCN0000128474 GCACTGATACACAGTTTACAT pLKO.1 2373 CDS 100% 5.625 3.938 N PKHD1L1 n/a
11 TRCN0000149123 GCCAGTTTAATCCTGTGGAAA pLKO.1 10383 CDS 100% 4.950 3.465 N PKHD1L1 n/a
12 TRCN0000148813 CGAGGGAATTTGATTGCACTT pLKO.1 10202 CDS 100% 4.050 2.835 N PKHD1L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013969.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.