Transcript: Human XM_017014114.2

PREDICTED: Homo sapiens kelch repeat and BTB domain containing 11 (KBTBD11), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KBTBD11 (9920)
Length:
7319
CDS:
1569..3440

Additional Resources:

NCBI RefSeq record:
XM_017014114.2
NBCI Gene record:
KBTBD11 (9920)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014114.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183182 GCAAGTAAACTGCATGTATTT pLKO.1 4550 3UTR 100% 13.200 18.480 N KBTBD11 n/a
2 TRCN0000147722 GCGTTTCATTTAGTGAAGGAA pLKO.1 5530 3UTR 100% 3.000 4.200 N KBTBD11 n/a
3 TRCN0000146349 CGTGCTTATCACCATAGATTT pLKO.1 4529 3UTR 100% 13.200 9.240 N KBTBD11 n/a
4 TRCN0000147901 GCGATTCTCAAATGTTACCAT pLKO.1 7116 3UTR 100% 3.000 2.100 N KBTBD11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014114.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.