Transcript: Human XM_017014254.1

PREDICTED: Homo sapiens ubiquitin like with PHD and ring finger domains 2 (UHRF2), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UHRF2 (115426)
Length:
3356
CDS:
913..2481

Additional Resources:

NCBI RefSeq record:
XM_017014254.1
NBCI Gene record:
UHRF2 (115426)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364093 GTAATGTGGCTTATCATATTT pLKO_005 1166 CDS 100% 15.000 12.000 N UHRF2 n/a
2 TRCN0000003479 CGTCTCTTCTTCCATTACAAT pLKO.1 2954 3UTR 100% 5.625 4.500 N UHRF2 n/a
3 TRCN0000368927 ATGTTGGACTGAATGATATAA pLKO_005 154 5UTR 100% 15.000 10.500 N UHRF2 n/a
4 TRCN0000003482 CTGCTGATGAAGACGTTATTT pLKO.1 574 5UTR 100% 15.000 10.500 N UHRF2 n/a
5 TRCN0000364095 TGCTGATGAAGACGTTATTTA pLKO_005 575 5UTR 100% 15.000 10.500 N UHRF2 n/a
6 TRCN0000364094 AGTGTACCCTCTACGTCTAAT pLKO_005 540 5UTR 100% 13.200 9.240 N UHRF2 n/a
7 TRCN0000412720 GATGCTCCATTGGATGATAAA pLKO_005 1696 CDS 100% 13.200 9.240 N Uhrf2 n/a
8 TRCN0000040626 GCAACAGATATGATGGCATTT pLKO.1 1814 CDS 100% 10.800 7.560 N Uhrf2 n/a
9 TRCN0000368926 GTACGAGAGAATGTACTATTG pLKO_005 1376 CDS 100% 10.800 7.560 N UHRF2 n/a
10 TRCN0000003481 ACTGGTATTGTCCTTCTTGTA pLKO.1 1229 CDS 100% 4.950 3.465 N UHRF2 n/a
11 TRCN0000003480 GAAGTTGTAAAGGCTGGTGAA pLKO.1 1264 CDS 100% 4.050 2.835 N UHRF2 n/a
12 TRCN0000010793 GTTGGTGATGTGGTAATGGTT pLKO.1 699 5UTR 100% 3.000 2.100 N UHRF2 n/a
13 TRCN0000040625 GCTGATGAAGACGTTATTTAT pLKO.1 576 5UTR 100% 15.000 10.500 N Uhrf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.