Transcript: Human XM_017014441.2

PREDICTED: Homo sapiens coiled-coil domain containing 171 (CCDC171), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC171 (203238)
Length:
4318
CDS:
471..4142

Additional Resources:

NCBI RefSeq record:
XM_017014441.2
NBCI Gene record:
CCDC171 (203238)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014441.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133653 GATTGCCTCATTGGATGTAAA pLKO.1 518 CDS 100% 13.200 18.480 N CCDC171 n/a
2 TRCN0000136803 CGGCGACAAACAAGTGAACTT pLKO.1 1227 CDS 100% 4.950 3.960 N CCDC171 n/a
3 TRCN0000136943 GCAGACCGAGAGGCTTTAATA pLKO.1 2046 CDS 100% 15.000 10.500 N CCDC171 n/a
4 TRCN0000135448 GCCCATGGACTTCATAAAGTA pLKO.1 3324 CDS 100% 5.625 3.938 N CCDC171 n/a
5 TRCN0000134573 GTCAGCTCAATAGACATCTTA pLKO.1 3811 CDS 100% 5.625 3.938 N CCDC171 n/a
6 TRCN0000134404 GCAGAAGCAAATACTTGGATT pLKO.1 3410 CDS 100% 4.950 3.465 N CCDC171 n/a
7 TRCN0000135536 CCTTTCAAAGAGACTCCAGTA pLKO.1 1622 CDS 100% 4.050 2.835 N CCDC171 n/a
8 TRCN0000135289 CGGAAAGGTGTTATTGCTGTT pLKO.1 2898 CDS 100% 4.050 2.835 N CCDC171 n/a
9 TRCN0000134638 GAGAGGCTTTAATAAGCACTT pLKO.1 2053 CDS 100% 4.050 2.835 N CCDC171 n/a
10 TRCN0000135632 GCTAATCACATGAGAGCAGTA pLKO.1 3924 CDS 100% 4.050 2.835 N CCDC171 n/a
11 TRCN0000147198 CTTCTTAAGCAACTTCAGCAA pLKO.1 4191 3UTR 100% 2.640 1.848 N POT1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014441.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.