Transcript: Human XM_017014555.1

PREDICTED: Homo sapiens PHD finger protein 24 (PHF24), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHF24 (23349)
Length:
5885
CDS:
232..1452

Additional Resources:

NCBI RefSeq record:
XM_017014555.1
NBCI Gene record:
PHF24 (23349)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014555.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202310 GAGACCTTTCAGCGGTGTAAA pLKO.1 859 CDS 100% 13.200 18.480 N Phf24 n/a
2 TRCN0000249756 GAGACCTTTCAGCGGTGTAAA pLKO_005 859 CDS 100% 13.200 18.480 N Phf24 n/a
3 TRCN0000263372 GAGACCTTTCAGCGGTGTAAA pLKO_005 859 CDS 100% 13.200 18.480 N PHF24 n/a
4 TRCN0000263371 GGCTTCTGTTTCCAACTTAAT pLKO_005 2857 3UTR 100% 13.200 9.240 N PHF24 n/a
5 TRCN0000263373 TGATGACAAACCTCCAGAAAT pLKO_005 582 CDS 100% 13.200 9.240 N PHF24 n/a
6 TRCN0000263374 CGATGAGATGTGTGATGTTTG pLKO_005 633 CDS 100% 10.800 7.560 N PHF24 n/a
7 TRCN0000263370 CTGAACATCGAGGCCACATAG pLKO_005 1016 CDS 100% 10.800 7.560 N PHF24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014555.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.