Transcript: Human XM_017014558.1

PREDICTED: Homo sapiens exosome component 2 (EXOSC2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EXOSC2 (23404)
Length:
2538
CDS:
901..1446

Additional Resources:

NCBI RefSeq record:
XM_017014558.1
NBCI Gene record:
EXOSC2 (23404)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014558.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049843 CGCGACACTAAGAAACATCTA pLKO.1 75 5UTR 100% 4.950 3.960 N EXOSC2 n/a
2 TRCN0000369628 GGGCTCCCATCCTGGAATAAT pLKO_005 1718 3UTR 100% 15.000 10.500 N EXOSC2 n/a
3 TRCN0000369627 TCCATTCCTATATCCTTTAAA pLKO_005 1850 3UTR 100% 15.000 10.500 N EXOSC2 n/a
4 TRCN0000049844 GACATCTTAAAGCCAGAAATA pLKO.1 1372 CDS 100% 13.200 9.240 N EXOSC2 n/a
5 TRCN0000318911 GACATCTTAAAGCCAGAAATA pLKO_005 1372 CDS 100% 13.200 9.240 N EXOSC2 n/a
6 TRCN0000049846 GAGAAGCTCATTGCATCTGTT pLKO.1 165 5UTR 100% 4.950 3.465 N EXOSC2 n/a
7 TRCN0000318908 GAGAAGCTCATTGCATCTGTT pLKO_005 165 5UTR 100% 4.950 3.465 N EXOSC2 n/a
8 TRCN0000049845 CCCACTTTCATGATTTGCCAT pLKO.1 1115 CDS 100% 2.640 1.848 N EXOSC2 n/a
9 TRCN0000318910 CCCACTTTCATGATTTGCCAT pLKO_005 1115 CDS 100% 2.640 1.848 N EXOSC2 n/a
10 TRCN0000049847 GCTGTATGATACCAGCATCCT pLKO.1 1314 CDS 100% 2.640 1.848 N EXOSC2 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 724 5UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 1939 3UTR 100% 4.950 2.475 Y NPHS1 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 724 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014558.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.