Transcript: Human XM_017014571.1

PREDICTED: Homo sapiens transmembrane protein 245 (TMEM245), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM245 (23731)
Length:
7953
CDS:
33..2645

Additional Resources:

NCBI RefSeq record:
XM_017014571.1
NBCI Gene record:
TMEM245 (23731)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338732 AGCGGACTTTCCGTGACATTT pLKO_005 2596 CDS 100% 13.200 18.480 N TMEM245 n/a
2 TRCN0000338734 CGCTTCGACAAGCCCATTAAG pLKO_005 165 CDS 100% 13.200 18.480 N TMEM245 n/a
3 TRCN0000130038 GCTATGTGTTGACTGTTTCAT pLKO.1 631 CDS 100% 5.625 7.875 N TMEM245 n/a
4 TRCN0000338721 GCTATGTGTTGACTGTTTCAT pLKO_005 631 CDS 100% 5.625 7.875 N TMEM245 n/a
5 TRCN0000128274 GCTGTATTAGTGTTCCTTCTA pLKO.1 3841 3UTR 100% 4.950 6.930 N TMEM245 n/a
6 TRCN0000338735 GTATCAGTATGGACGAGAATG pLKO_005 1595 CDS 100% 10.800 8.640 N TMEM245 n/a
7 TRCN0000130381 GCTGGCTTCTATGGATTGTAT pLKO.1 2157 CDS 100% 5.625 4.500 N TMEM245 n/a
8 TRCN0000129040 GCCAGGTCCTTCTTCTAATAT pLKO.1 2078 CDS 100% 15.000 10.500 N TMEM245 n/a
9 TRCN0000338733 GGAGTCTCTGTGGATCGTTAT pLKO_005 1865 CDS 100% 10.800 7.560 N TMEM245 n/a
10 TRCN0000129675 CCAGAGTTCTTTACTAGACAT pLKO.1 7469 3UTR 100% 4.950 3.465 N TMEM245 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.