Transcript: Human XM_017014596.2

PREDICTED: Homo sapiens CDKN1A interacting zinc finger protein 1 (CIZ1), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CIZ1 (25792)
Length:
2811
CDS:
151..2679

Additional Resources:

NCBI RefSeq record:
XM_017014596.2
NBCI Gene record:
CIZ1 (25792)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014596.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154035 CAAACACCAGTTGTGGTTCAT pLKO.1 1414 CDS 100% 4.950 3.465 N CIZ1 n/a
2 TRCN0000292348 CAAACACCAGTTGTGGTTCAT pLKO_005 1414 CDS 100% 4.950 3.465 N CIZ1 n/a
3 TRCN0000151763 CACTCCAAATTTGCAACAGTT pLKO.1 579 CDS 100% 4.950 3.465 N CIZ1 n/a
4 TRCN0000292302 CACTCCAAATTTGCAACAGTT pLKO_005 579 CDS 100% 4.950 3.465 N CIZ1 n/a
5 TRCN0000155699 CCAAGTCAGCATGGAAGAGAT pLKO.1 1515 CDS 100% 4.950 3.465 N CIZ1 n/a
6 TRCN0000151866 CCAATCGAAAGGATTCTTCTT pLKO.1 728 CDS 100% 4.950 3.465 N CIZ1 n/a
7 TRCN0000154634 CCTCCAGTTCTTCTGCTACAT pLKO.1 1752 CDS 100% 4.950 3.465 N CIZ1 n/a
8 TRCN0000156000 CGTTTGCAACCGCTACTTCAA pLKO.1 2046 CDS 100% 4.950 3.465 N CIZ1 n/a
9 TRCN0000155162 GCACTTAGTGCTGCAACAGAA pLKO.1 1206 CDS 100% 4.950 3.465 N CIZ1 n/a
10 TRCN0000292350 GCACTTAGTGCTGCAACAGAA pLKO_005 1206 CDS 100% 4.950 3.465 N CIZ1 n/a
11 TRCN0000155369 CCACTTTGAGAACCTGCAGAA pLKO.1 2451 CDS 100% 4.050 2.835 N CIZ1 n/a
12 TRCN0000153258 GAGGATGATGAGGATGAAGAA pLKO.1 2224 CDS 100% 4.950 2.970 N CIZ1 n/a
13 TRCN0000292349 GAGGATGATGAGGATGAAGAA pLKO_005 2224 CDS 100% 4.950 2.970 N CIZ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014596.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.