Transcript: Human XM_017014670.1

PREDICTED: Homo sapiens amyloid beta precursor protein binding family A member 1 (APBA1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
APBA1 (320)
Length:
6829
CDS:
521..3034

Additional Resources:

NCBI RefSeq record:
XM_017014670.1
NBCI Gene record:
APBA1 (320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063867 ACAGGCATTTAGCGTGGCATA pLKO.1 2335 CDS 100% 4.050 5.670 N APBA1 n/a
2 TRCN0000063864 CCACTAATAAAGAGTCAAGAA pLKO.1 1803 CDS 100% 4.950 3.465 N APBA1 n/a
3 TRCN0000063866 CCAGAGCATTATTAAGGGCTT pLKO.1 2686 CDS 100% 2.160 1.512 N APBA1 n/a
4 TRCN0000063863 CCAACCTTAAACCTCTTCTAT pLKO.1 3572 3UTR 100% 5.625 2.813 Y APBA1 n/a
5 TRCN0000063865 GCACCGGATCATTGAAATCAA pLKO.1 2875 CDS 100% 5.625 2.813 Y APBA1 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3800 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.