Transcript: Human XM_017014712.1

PREDICTED: Homo sapiens lipocalin 9 (LCN9), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LCN9 (392399)
Length:
684
CDS:
1..684

Additional Resources:

NCBI RefSeq record:
XM_017014712.1
NBCI Gene record:
LCN9 (392399)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059308 CGGCAGCCTAATATTTGATTT pLKO.1 204 CDS 100% 13.200 18.480 N LCN9 n/a
2 TRCN0000059310 CCGGAATATTGAACACTTGAA pLKO.1 180 CDS 100% 4.950 6.930 N LCN9 n/a
3 TRCN0000059312 GATGACCTGAATCGGATTAAA pLKO.1 133 CDS 100% 15.000 12.000 N LCN9 n/a
4 TRCN0000059309 CGTTATGCAGAGGAACTACAA pLKO.1 66 CDS 100% 4.950 3.960 N LCN9 n/a
5 TRCN0000059311 GACTGACTACAGGCTGTTCAT pLKO.1 339 CDS 100% 4.950 3.465 N LCN9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.