Transcript: Human XM_017014839.1

PREDICTED: Homo sapiens centlein (CNTLN), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNTLN (54875)
Length:
5682
CDS:
76..4293

Additional Resources:

NCBI RefSeq record:
XM_017014839.1
NBCI Gene record:
CNTLN (54875)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014839.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431152 TATTACGAGAACGGATTATAT pLKO_005 3023 CDS 100% 15.000 21.000 N CNTLN n/a
2 TRCN0000129436 GCAGGCTTGGTACACACAAAT pLKO.1 4699 3UTR 100% 13.200 18.480 N CNTLN n/a
3 TRCN0000149413 CCACGGATACAAGTTACATCA pLKO.1 3304 CDS 100% 4.950 6.930 N CNTLN n/a
4 TRCN0000146867 CGGATACAAGTTACATCACTT pLKO.1 3307 CDS 100% 4.950 6.930 N CNTLN n/a
5 TRCN0000434488 GTGGAATGAACTGGCATATTT pLKO_005 1908 CDS 100% 15.000 12.000 N CNTLN n/a
6 TRCN0000150198 GCGACAAATAAGAGAGCTTAA pLKO.1 3972 CDS 100% 10.800 7.560 N CNTLN n/a
7 TRCN0000181921 CTGCTAAATGACCTGGAGAAA pLKO.1 844 CDS 100% 4.950 3.465 N Cntln n/a
8 TRCN0000131183 GCAGCATCTAAGCAGCTTCAA pLKO.1 3814 CDS 100% 4.950 3.465 N CNTLN n/a
9 TRCN0000150096 CCAACTATCAATAGTCAGGTT pLKO.1 4503 3UTR 100% 2.640 1.848 N CNTLN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014839.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.