Transcript: Human XM_017014907.1

PREDICTED: Homo sapiens kinesin family member 27 (KIF27), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF27 (55582)
Length:
8616
CDS:
403..4410

Additional Resources:

NCBI RefSeq record:
XM_017014907.1
NBCI Gene record:
KIF27 (55582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116653 CGGTTCAAAGAATCCATTCAA pLKO.1 1180 CDS 100% 5.625 7.875 N KIF27 n/a
2 TRCN0000116656 GAACGGTTCAAAGAATCCATT pLKO.1 1177 CDS 100% 4.950 6.930 N KIF27 n/a
3 TRCN0000417814 AGTTCTGGAACGGGATAATAT pLKO_005 3624 CDS 100% 15.000 10.500 N KIF27 n/a
4 TRCN0000454988 AGTCGACTGTCATCCCAAATT pLKO_005 4207 CDS 100% 13.200 9.240 N KIF27 n/a
5 TRCN0000116654 CCTCACCTCATTTCGAGGAAT pLKO.1 1761 CDS 100% 4.950 3.465 N KIF27 n/a
6 TRCN0000116652 GCTCAAGTTCACTACCTCTTT pLKO.1 4479 3UTR 100% 4.950 3.465 N KIF27 n/a
7 TRCN0000116655 CCCTTGTTGAATTGAGTGATA pLKO.1 2426 CDS 100% 4.950 2.475 Y KIF27 n/a
8 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 297 5UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.