Transcript: Human XM_017014911.2

PREDICTED: Homo sapiens kinesin family member 27 (KIF27), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF27 (55582)
Length:
7975
CDS:
638..3769

Additional Resources:

NCBI RefSeq record:
XM_017014911.2
NBCI Gene record:
KIF27 (55582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014911.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417814 AGTTCTGGAACGGGATAATAT pLKO_005 2983 CDS 100% 15.000 10.500 N KIF27 n/a
2 TRCN0000454988 AGTCGACTGTCATCCCAAATT pLKO_005 3566 CDS 100% 13.200 9.240 N KIF27 n/a
3 TRCN0000116654 CCTCACCTCATTTCGAGGAAT pLKO.1 922 CDS 100% 4.950 3.465 N KIF27 n/a
4 TRCN0000116652 GCTCAAGTTCACTACCTCTTT pLKO.1 3838 3UTR 100% 4.950 3.465 N KIF27 n/a
5 TRCN0000116655 CCCTTGTTGAATTGAGTGATA pLKO.1 1587 CDS 100% 4.950 2.475 Y KIF27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014911.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.