Transcript: Human XM_017014918.1

PREDICTED: Homo sapiens DENN domain containing 4C (DENND4C), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DENND4C (55667)
Length:
7503
CDS:
963..6131

Additional Resources:

NCBI RefSeq record:
XM_017014918.1
NBCI Gene record:
DENND4C (55667)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014918.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166253 CCTAGTAACTTGCCAGGACTT pLKO.1 5604 CDS 100% 4.050 5.670 N DENND4C n/a
2 TRCN0000160446 CAACAGTTAGTCTTCCAAATA pLKO.1 5377 CDS 100% 13.200 10.560 N DENND4C n/a
3 TRCN0000161871 GCAGAGTATTCAGCACAATAA pLKO.1 5849 CDS 100% 13.200 9.240 N DENND4C n/a
4 TRCN0000160350 CCAGGGCTTATTAATATTGAA pLKO.1 6319 3UTR 100% 5.625 3.938 N DENND4C n/a
5 TRCN0000160762 CACTAGAATGTTGACACACAA pLKO.1 6141 3UTR 100% 4.950 3.465 N DENND4C n/a
6 TRCN0000164303 CCAGTTGAAGATGCAGTCTTT pLKO.1 3441 CDS 100% 4.950 3.465 N DENND4C n/a
7 TRCN0000165061 GCCCAAGATAGATGTCCTGAA pLKO.1 4469 CDS 100% 4.050 2.835 N DENND4C n/a
8 TRCN0000161142 CCTTGAAATATGAAGTGCCAT pLKO.1 6289 3UTR 100% 2.640 1.848 N DENND4C n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6566 3UTR 100% 13.200 6.600 Y LIAS n/a
10 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 6725 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014918.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.