Transcript: Human XM_017015108.1

PREDICTED: Homo sapiens vav guanine nucleotide exchange factor 2 (VAV2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VAV2 (7410)
Length:
4955
CDS:
97..2787

Additional Resources:

NCBI RefSeq record:
XM_017015108.1
NBCI Gene record:
VAV2 (7410)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048223 GCCACGATAAATTTGGATTAA pLKO.1 341 CDS 100% 13.200 18.480 N VAV2 n/a
2 TRCN0000418821 ACAGCATCGCGCAGAACAAAG pLKO_005 449 CDS 100% 10.800 15.120 N VAV2 n/a
3 TRCN0000423931 GTGGACAAGACTCGCAGATTT pLKO_005 2798 3UTR 100% 13.200 10.560 N VAV2 n/a
4 TRCN0000048226 CCCGAGATATGAGGGAGCTTT pLKO.1 2636 CDS 100% 4.950 3.960 N VAV2 n/a
5 TRCN0000048227 CAAGTGAAACTGGAGGAATTT pLKO.1 1285 CDS 100% 13.200 9.240 N VAV2 n/a
6 TRCN0000436728 CCATGCAGAGGGTGCTCAAAT pLKO_005 1091 CDS 100% 13.200 9.240 N VAV2 n/a
7 TRCN0000435647 CAATAAGCATCAAGTTCAATG pLKO_005 2273 CDS 100% 10.800 7.560 N VAV2 n/a
8 TRCN0000419630 TGGGTATGCTATTGTACATAG pLKO_005 2984 3UTR 100% 10.800 7.560 N VAV2 n/a
9 TRCN0000426913 CAAGGTCTTCCTCGATTTCAA pLKO_005 906 CDS 100% 5.625 3.938 N VAV2 n/a
10 TRCN0000048225 GCGAGACTTTGGAAAGGTCAT pLKO.1 402 CDS 100% 4.050 2.835 N VAV2 n/a
11 TRCN0000048224 GACAGGTACTTGTTCCTGTTT pLKO.1 1366 CDS 100% 0.495 0.347 N VAV2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.