Transcript: Human XM_017015162.1

PREDICTED: Homo sapiens nuclear receptor subfamily 4 group A member 3 (NR4A3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NR4A3 (8013)
Length:
5568
CDS:
662..2542

Additional Resources:

NCBI RefSeq record:
XM_017015162.1
NBCI Gene record:
NR4A3 (8013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019563 CGAAGAGCTATGCAACAAGAT pLKO.1 2326 CDS 100% 4.950 6.930 N NR4A3 n/a
2 TRCN0000019562 GCTCGACTCTATTAAAGACTT pLKO.1 2200 CDS 100% 4.950 6.930 N NR4A3 n/a
3 TRCN0000423054 GGTTTGGAAACCTATCATTTC pLKO_005 2609 3UTR 100% 10.800 8.640 N NR4A3 n/a
4 TRCN0000432732 AGAAGATCAGACATTACTTAT pLKO_005 2050 CDS 100% 13.200 9.240 N NR4A3 n/a
5 TRCN0000025974 GCAGAGCCTGAACCTTGATAT pLKO.1 2233 CDS 100% 13.200 9.240 N Nr4a3 n/a
6 TRCN0000019559 GCAGACATACAGCTCGGAATA pLKO.1 718 CDS 100% 10.800 7.560 N NR4A3 n/a
7 TRCN0000432153 GCTGAGCATGTGCAACAATTC pLKO_005 1952 CDS 100% 10.800 7.560 N NR4A3 n/a
8 TRCN0000019561 CCTCCATTGATGTATCCAGAA pLKO.1 1989 CDS 100% 4.050 2.835 N NR4A3 n/a
9 TRCN0000019560 GCCCATTACAACAGGAACCTT pLKO.1 1800 CDS 100% 3.000 2.100 N NR4A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.