Transcript: Human XM_017015494.1

PREDICTED: Homo sapiens transforming acidic coiled-coil containing protein 2 (TACC2), transcript variant X33, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TACC2 (10579)
Length:
3837
CDS:
451..3351

Additional Resources:

NCBI RefSeq record:
XM_017015494.1
NBCI Gene record:
TACC2 (10579)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107111 GCAGTGCTTCTAGTACCCTTA pLKO.1 1088 CDS 100% 4.050 5.670 N TACC2 n/a
2 TRCN0000107113 CCCTAAAGACTGACACATTTA pLKO.1 2009 CDS 100% 13.200 9.240 N TACC2 n/a
3 TRCN0000107114 CAGTGCTTCTAGTACCCTTAA pLKO.1 1089 CDS 100% 10.800 7.560 N TACC2 n/a
4 TRCN0000333577 CAGTGCTTCTAGTACCCTTAA pLKO_005 1089 CDS 100% 10.800 7.560 N TACC2 n/a
5 TRCN0000107110 CACTACTGTATTTCCTTTCTA pLKO.1 3458 3UTR 100% 5.625 3.938 N TACC2 n/a
6 TRCN0000333655 CACTACTGTATTTCCTTTCTA pLKO_005 3458 3UTR 100% 5.625 3.938 N TACC2 n/a
7 TRCN0000107112 GCTCAGATGATAGAGGACGAA pLKO.1 2884 CDS 100% 2.640 1.848 N TACC2 n/a
8 TRCN0000333654 GCTCAGATGATAGAGGACGAA pLKO_005 2884 CDS 100% 2.640 1.848 N TACC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.