Transcript: Human XM_017015601.2

PREDICTED: Homo sapiens arginyltransferase 1 (ATE1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATE1 (11101)
Length:
1684
CDS:
27..989

Additional Resources:

NCBI RefSeq record:
XM_017015601.2
NBCI Gene record:
ATE1 (11101)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015601.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034669 CGGGTGACTTTGCATTGATAA pLKO.1 202 CDS 100% 13.200 18.480 N ATE1 n/a
2 TRCN0000366598 GGAGTCTTACCAGGTCTATAA pLKO_005 695 CDS 100% 13.200 18.480 N Ate1 n/a
3 TRCN0000034673 CACAATAAGGTGCCGACCTTT pLKO.1 53 CDS 100% 0.495 0.693 N ATE1 n/a
4 TRCN0000124628 GAGTCTTACCAGGTCTATAAA pLKO.1 696 CDS 100% 15.000 10.500 N Ate1 n/a
5 TRCN0000034671 GATGACATCAAAGAGAGTTTA pLKO.1 261 CDS 100% 13.200 9.240 N ATE1 n/a
6 TRCN0000435990 GGATATACAGTGTGATCTTAA pLKO_005 230 CDS 100% 13.200 9.240 N ATE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015601.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.