Transcript: Human XM_017015630.1

PREDICTED: Homo sapiens cilia and flagella associated protein 70 (CFAP70), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFAP70 (118491)
Length:
5185
CDS:
2179..4968

Additional Resources:

NCBI RefSeq record:
XM_017015630.1
NBCI Gene record:
CFAP70 (118491)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015630.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431893 GATGTGCAGGCACCTAGTATA pLKO_005 2890 CDS 100% 13.200 18.480 N CFAP70 n/a
2 TRCN0000136258 GACAGCGAATTTAGGAATCAA pLKO.1 2395 CDS 100% 5.625 7.875 N CFAP70 n/a
3 TRCN0000430753 AGGCACTGTTGCAACCATTTA pLKO_005 3477 CDS 100% 13.200 9.240 N CFAP70 n/a
4 TRCN0000433890 CAGATGCATGTAGCCCTAAAC pLKO_005 3433 CDS 100% 10.800 7.560 N CFAP70 n/a
5 TRCN0000135365 GCAGAAGTCAATGAGAACTTT pLKO.1 3535 CDS 100% 5.625 3.938 N CFAP70 n/a
6 TRCN0000138727 GCTGTCCTGTTGGAGAACTAT pLKO.1 3739 CDS 100% 5.625 3.938 N CFAP70 n/a
7 TRCN0000138209 CAAGAGTTCCTCTGGTCACTA pLKO.1 2537 CDS 100% 4.950 3.465 N CFAP70 n/a
8 TRCN0000136967 CCTCCTAACTGAAGACAACAT pLKO.1 3639 CDS 100% 4.950 3.465 N CFAP70 n/a
9 TRCN0000138011 GCATTTCATGAGGCCTCCAAA pLKO.1 3877 CDS 100% 4.950 3.465 N CFAP70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015630.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.