Transcript: Human XM_017015900.1

PREDICTED: Homo sapiens jumonji domain containing 1C (JMJD1C), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
JMJD1C (221037)
Length:
8771
CDS:
1189..7947

Additional Resources:

NCBI RefSeq record:
XM_017015900.1
NBCI Gene record:
JMJD1C (221037)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107563 CCCATTTACTAGCCGGATCAT pLKO.1 2609 CDS 100% 4.950 6.930 N JMJD1C n/a
2 TRCN0000107562 GCGGAATCAATTAGTCTTGAT pLKO.1 6946 CDS 100% 0.495 0.693 N JMJD1C n/a
3 TRCN0000107564 GCCTCTCATTTGCCAGGATTT pLKO.1 7222 CDS 100% 10.800 8.640 N JMJD1C n/a
4 TRCN0000358696 GAGATGTGGAGACCTAATAAT pLKO_005 4144 CDS 100% 15.000 10.500 N JMJD1C n/a
5 TRCN0000358763 GGATCTGTGAGAAGCATATTT pLKO_005 6806 CDS 100% 15.000 10.500 N JMJD1C n/a
6 TRCN0000358695 TCCACCTCCAGAGACTATAAA pLKO_005 2175 CDS 100% 15.000 10.500 N JMJD1C n/a
7 TRCN0000107560 GCTCCTGTGATTCAATGTTAT pLKO.1 8115 3UTR 100% 13.200 9.240 N JMJD1C n/a
8 TRCN0000107561 GCGTCCATCTTCTAGTACAAA pLKO.1 4245 CDS 100% 5.625 3.938 N JMJD1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.