Transcript: Human XM_017015905.2

PREDICTED: Homo sapiens family with sequence similarity 171 member A1 (FAM171A1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM171A1 (221061)
Length:
3603
CDS:
733..2331

Additional Resources:

NCBI RefSeq record:
XM_017015905.2
NBCI Gene record:
FAM171A1 (221061)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015905.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168320 GCGAGCTGAATGTGACTATTA pLKO.1 3445 3UTR 100% 13.200 18.480 N FAM171A1 n/a
2 TRCN0000238528 TATGAAGATGTCGTCCAAATA pLKO_005 155 5UTR 100% 13.200 18.480 N Fam171a1 n/a
3 TRCN0000264229 TATGAAGATGTCGTCCAAATA pLKO_005 155 5UTR 100% 13.200 18.480 N FAM171A1 n/a
4 TRCN0000264230 TTGCGAGGATTAGACGGAAAT pLKO_005 323 5UTR 100% 10.800 15.120 N FAM171A1 n/a
5 TRCN0000168230 CGCTCACGTTAGACATTCATA pLKO.1 1809 CDS 100% 5.625 7.875 N FAM171A1 n/a
6 TRCN0000168035 CGGAAGTAATGATGCCAGTTT pLKO.1 1857 CDS 100% 4.950 3.960 N FAM171A1 n/a
7 TRCN0000238529 GCTGGAAGGAACGGAAGTAAT pLKO_005 1846 CDS 100% 13.200 9.240 N Fam171a1 n/a
8 TRCN0000264233 TTTGGACTCTGGCGTAGATAT pLKO_005 1875 CDS 100% 13.200 9.240 N FAM171A1 n/a
9 TRCN0000264232 CATTCCTGTTTGCCGTGTAAA pLKO_005 2459 3UTR 100% 13.200 7.920 N FAM171A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015905.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.