Transcript: Human XM_017015983.1

PREDICTED: Homo sapiens PPARG related coactivator 1 (PPRC1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPRC1 (23082)
Length:
5149
CDS:
34..4845

Additional Resources:

NCBI RefSeq record:
XM_017015983.1
NBCI Gene record:
PPRC1 (23082)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015983.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437395 AGATGCCTGCCCTAGTCATTC pLKO_005 3773 CDS 100% 10.800 15.120 N PPRC1 n/a
2 TRCN0000429398 CAGTACTACCTGATCCGTTTA pLKO_005 2756 CDS 100% 10.800 15.120 N PPRC1 n/a
3 TRCN0000430808 CCTAGTCTTCCATTGTCTATG pLKO_005 2731 CDS 100% 10.800 15.120 N PPRC1 n/a
4 TRCN0000428938 TTATCGTTCACATGACCATTA pLKO_005 4410 CDS 100% 10.800 15.120 N PPRC1 n/a
5 TRCN0000063294 GCACCTGTAAAGAGCAAATTT pLKO.1 4768 CDS 100% 15.000 10.500 N PPRC1 n/a
6 TRCN0000424176 AGTTGACCCAGTGCTAGTTAA pLKO_005 2073 CDS 100% 13.200 9.240 N PPRC1 n/a
7 TRCN0000063296 CCTGATCCGTTTACTCACTAT pLKO.1 2764 CDS 100% 4.950 3.465 N PPRC1 n/a
8 TRCN0000063295 GCTGACACTATCCAAACCAAT pLKO.1 1717 CDS 100% 4.950 3.465 N PPRC1 n/a
9 TRCN0000063293 CCTCTTTCTTAGAGACCTCTT pLKO.1 668 CDS 100% 4.050 2.835 N PPRC1 n/a
10 TRCN0000417601 GGCCCTTCCCTGCTATCCTTT pLKO_005 4851 3UTR 100% 1.650 1.155 N PPRC1 n/a
11 TRCN0000436006 GGGAGAGAGCTGCTAGTGAGA pLKO_005 4921 3UTR 100% 0.880 0.616 N PPRC1 n/a
12 TRCN0000063297 CCAGTTGATCTAGCACTGGTT pLKO.1 2026 CDS 100% 0.264 0.185 N PPRC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015983.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.