Transcript: Human XM_017016032.2

PREDICTED: Homo sapiens heat shock protein family A (Hsp70) member 12A (HSPA12A), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HSPA12A (259217)
Length:
5472
CDS:
384..1883

Additional Resources:

NCBI RefSeq record:
XM_017016032.2
NBCI Gene record:
HSPA12A (259217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237977 TTACCGGAGGGACACCTTAAG pLKO_005 843 CDS 100% 10.800 15.120 N HSPA12A n/a
2 TRCN0000237980 CAATTGTCCCTGGCATATTAT pLKO_005 4859 3UTR 100% 15.000 10.500 N HSPA12A n/a
3 TRCN0000237981 GGCGGACCCTATGGATCTTTA pLKO_005 882 CDS 100% 13.200 9.240 N HSPA12A n/a
4 TRCN0000237979 ACTCGGAGCAGCTCATCATTG pLKO_005 541 CDS 100% 10.800 7.560 N HSPA12A n/a
5 TRCN0000248697 ACTCGGAGCAGCTCATCATTG pLKO_005 541 CDS 100% 10.800 7.560 N Hspa12a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.