Transcript: Human XM_017016066.2

PREDICTED: Homo sapiens erythroid differentiation regulatory factor 1 (EDRF1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EDRF1 (26098)
Length:
4434
CDS:
1100..3763

Additional Resources:

NCBI RefSeq record:
XM_017016066.2
NBCI Gene record:
EDRF1 (26098)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016066.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144108 CACGGGTCTAAGATATGATTA pLKO.1 4079 3UTR 100% 13.200 18.480 N EDRF1 n/a
2 TRCN0000122332 CGCGACTCTTCTGGAAAGAAT pLKO.1 3673 CDS 100% 5.625 7.875 N EDRF1 n/a
3 TRCN0000142936 CTTCCGCCAATTACATGCTTT pLKO.1 1551 CDS 100% 4.950 6.930 N EDRF1 n/a
4 TRCN0000121579 CCAGAAGAAGGCTTGTATTAT pLKO.1 2834 CDS 100% 15.000 10.500 N EDRF1 n/a
5 TRCN0000144797 GCAGTTACACTTTCACGTATT pLKO.1 4039 3UTR 100% 10.800 7.560 N EDRF1 n/a
6 TRCN0000191999 GCTGATTCTCAAGTCATCAAA pLKO.1 2107 CDS 100% 5.625 3.938 N Edrf1 n/a
7 TRCN0000141069 CGCATAGGAAGGACTCTCTTA pLKO.1 532 5UTR 100% 4.950 3.465 N EDRF1 n/a
8 TRCN0000141014 CGTCCAGTTCAGATCAGACAA pLKO.1 779 5UTR 100% 4.950 3.465 N EDRF1 n/a
9 TRCN0000144826 GCCAATTACATGCTTTCAGAA pLKO.1 1556 CDS 100% 4.950 3.465 N EDRF1 n/a
10 TRCN0000142986 CCTAGTCTCAATCGAGAAGAA pLKO.1 3479 CDS 100% 4.950 2.970 N EDRF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016066.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.