Transcript: Human XM_017016088.2

PREDICTED: Homo sapiens DNA polymerase lambda (POLL), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POLL (27343)
Length:
1287
CDS:
101..1201

Additional Resources:

NCBI RefSeq record:
XM_017016088.2
NBCI Gene record:
POLL (27343)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016088.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053130 ACTCACATTGTGGTGGATGAA pLKO.1 341 CDS 100% 4.950 3.960 N POLL n/a
2 TRCN0000425960 TGTGTGGCATGTGGTTCATAC pLKO_005 1027 CDS 100% 10.800 7.560 N POLL n/a
3 TRCN0000415738 AGCCCATCTCTGATGATGAAG pLKO_005 668 CDS 100% 4.950 3.465 N POLL n/a
4 TRCN0000053132 AGCTGGATTCAGCATCTTCAT pLKO.1 481 CDS 100% 4.950 3.465 N POLL n/a
5 TRCN0000053128 CGACCAATCACAACCTCCATA pLKO.1 842 CDS 100% 4.950 3.465 N POLL n/a
6 TRCN0000447193 TGGTGATGTCGACGTGCTCAT pLKO_005 1068 CDS 100% 4.050 2.835 N POLL n/a
7 TRCN0000053131 CAAGAGGAGAATGGTCAGCAA pLKO.1 1204 3UTR 100% 2.640 1.848 N POLL n/a
8 TRCN0000111458 ACTCTTTGAGAAGCAGATTAT pLKO.1 277 CDS 100% 13.200 9.240 N Poll n/a
9 TRCN0000288223 ACTCTTTGAGAAGCAGATTAT pLKO_005 277 CDS 100% 13.200 9.240 N Poll n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016088.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.