Transcript: Human XM_017016127.1

PREDICTED: Homo sapiens ankyrin 3 (ANK3), transcript variant X32, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANK3 (288)
Length:
9536
CDS:
280..8091

Additional Resources:

NCBI RefSeq record:
XM_017016127.1
NBCI Gene record:
ANK3 (288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016127.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116333 CCGTTTGGTAAAGAGACATAA pLKO.1 3279 CDS 100% 13.200 18.480 N ANK3 n/a
2 TRCN0000116334 GCCGTTTGGTAAAGAGACATA pLKO.1 3278 CDS 100% 4.950 6.930 N ANK3 n/a
3 TRCN0000116336 CCGTAGAATCTTCCTTGCGAT pLKO.1 4181 CDS 100% 2.640 3.696 N ANK3 n/a
4 TRCN0000090055 CCACAACTGATGCCTTAACTT pLKO.1 7403 CDS 100% 5.625 4.500 N Ank3 n/a
5 TRCN0000271428 ACAACTCCTTTGACGTTTATA pLKO_005 4000 CDS 100% 15.000 10.500 N ANK3 n/a
6 TRCN0000284381 CTGCTAGAAGGACCAATATTT pLKO_005 7462 CDS 100% 15.000 10.500 N ANK3 n/a
7 TRCN0000271426 ACGGTCAGTCAAGGATCATAA pLKO_005 8098 3UTR 100% 13.200 9.240 N ANK3 n/a
8 TRCN0000116332 GCAGTGTCATATTAGGTTAAT pLKO.1 9327 3UTR 100% 13.200 9.240 N ANK3 n/a
9 TRCN0000271427 TGCAGTGGTTTCCCGGATTAA pLKO_005 3615 CDS 100% 13.200 9.240 N ANK3 n/a
10 TRCN0000271429 ACGGGATGAGAATCATCATTC pLKO_005 3221 CDS 100% 10.800 7.560 N ANK3 n/a
11 TRCN0000116335 GCAGCATATCAGAAATCTCTA pLKO.1 7858 CDS 100% 4.950 3.465 N ANK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016127.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.