Transcript: Human XM_017016862.2

PREDICTED: Homo sapiens golgi brefeldin A resistant guanine nucleotide exchange factor 1 (GBF1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GBF1 (8729)
Length:
6458
CDS:
262..5895

Additional Resources:

NCBI RefSeq record:
XM_017016862.2
NBCI Gene record:
GBF1 (8729)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016862.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155498 CGAGCACTACTTGTACATGAT pLKO.1 5023 CDS 100% 4.950 6.930 N GBF1 n/a
2 TRCN0000278959 CGAGCACTACTTGTACATGAT pLKO_005 5023 CDS 100% 4.950 6.930 N GBF1 n/a
3 TRCN0000154341 CTGCATAGTTTCGGTCATCTA pLKO.1 379 CDS 100% 4.950 6.930 N GBF1 n/a
4 TRCN0000278956 CTGCATAGTTTCGGTCATCTA pLKO_005 379 CDS 100% 4.950 6.930 N GBF1 n/a
5 TRCN0000157212 GCGAGTATGCTTCCTACTGTT pLKO.1 1794 CDS 100% 4.950 6.930 N GBF1 n/a
6 TRCN0000158157 CCATCAAACGAAATGCCCGAT pLKO.1 317 CDS 100% 2.160 3.024 N GBF1 n/a
7 TRCN0000109968 CCACGGGAACTAATTGAAATT pLKO.1 2395 CDS 100% 13.200 10.560 N Gbf1 n/a
8 TRCN0000326913 CCACGGGAACTAATTGAAATT pLKO_005 2395 CDS 100% 13.200 10.560 N Gbf1 n/a
9 TRCN0000157628 CACGACACTAAGTCTCTGCTT pLKO.1 4477 CDS 100% 2.640 2.112 N GBF1 n/a
10 TRCN0000278957 CACGACACTAAGTCTCTGCTT pLKO_005 4477 CDS 100% 2.640 2.112 N GBF1 n/a
11 TRCN0000311559 TGATGGACACAGCGGAGATTT pLKO_005 5345 CDS 100% 13.200 9.240 N Gbf1 n/a
12 TRCN0000155659 CAACCACTCTGCACTTTGTTT pLKO.1 6235 3UTR 100% 5.625 3.938 N GBF1 n/a
13 TRCN0000158301 CCAACCACTCTGCACTTTGTT pLKO.1 6234 3UTR 100% 5.625 3.938 N GBF1 n/a
14 TRCN0000278958 CCAACCACTCTGCACTTTGTT pLKO_005 6234 3UTR 100% 5.625 3.938 N GBF1 n/a
15 TRCN0000155407 CCTACGAGATGAACTCTTCAA pLKO.1 5448 CDS 100% 4.950 3.465 N GBF1 n/a
16 TRCN0000278888 CCTACGAGATGAACTCTTCAA pLKO_005 5448 CDS 100% 4.950 3.465 N GBF1 n/a
17 TRCN0000156557 GCAGCCAAGACAGTATTCCAT pLKO.1 3349 CDS 100% 3.000 2.100 N GBF1 n/a
18 TRCN0000158394 CACTTTGTTTCCCACTCCCAT pLKO.1 6246 3UTR 100% 2.640 1.848 N GBF1 n/a
19 TRCN0000306494 ACTATGATTGTGACTACTATT pLKO_005 1985 CDS 100% 13.200 9.240 N Gbf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016862.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.