Transcript: Human XM_017016967.2

PREDICTED: Homo sapiens SEC24 homolog C, COPII coat complex component (SEC24C), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEC24C (9632)
Length:
4521
CDS:
177..3455

Additional Resources:

NCBI RefSeq record:
XM_017016967.2
NBCI Gene record:
SEC24C (9632)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016967.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381081 CACCCAGACCCTGGCAATATT pLKO_005 3751 3UTR 100% 15.000 21.000 N SEC24C n/a
2 TRCN0000380070 GAAATTGGGACAGTAACATAT pLKO_005 3518 3UTR 100% 13.200 18.480 N SEC24C n/a
3 TRCN0000065160 CCTTTGACAAAGTCTCCCGTT pLKO.1 3027 CDS 100% 2.160 1.728 N SEC24C n/a
4 TRCN0000381549 CACCCAGCTGGCTGATCTATA pLKO_005 2666 CDS 100% 13.200 9.240 N SEC24C n/a
5 TRCN0000381332 GCTAAAGCAAGTGGGTAAATG pLKO_005 3451 CDS 100% 13.200 9.240 N SEC24C n/a
6 TRCN0000380441 CACTGTATATGATTCGGTATT pLKO_005 3717 3UTR 100% 10.800 7.560 N SEC24C n/a
7 TRCN0000065159 CCCTTCATGCAGTTCATTGAA pLKO.1 1470 CDS 100% 5.625 3.938 N SEC24C n/a
8 TRCN0000300152 CCCTTCATGCAGTTCATTGAA pLKO_005 1470 CDS 100% 5.625 3.938 N SEC24C n/a
9 TRCN0000065162 GCATGAAGCTACTCCCAGTTT pLKO.1 2869 CDS 100% 4.950 3.465 N SEC24C n/a
10 TRCN0000300220 GCATGAAGCTACTCCCAGTTT pLKO_005 2869 CDS 100% 4.950 3.465 N SEC24C n/a
11 TRCN0000065158 GCTCCACTGTTCAGATGCAAA pLKO.1 381 CDS 100% 4.950 3.465 N SEC24C n/a
12 TRCN0000300153 GCTCCACTGTTCAGATGCAAA pLKO_005 381 CDS 100% 4.950 3.465 N SEC24C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016967.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.