Transcript: Human XM_017016974.2

PREDICTED: Homo sapiens G protein regulated inducer of neurite outgrowth 2 (GPRIN2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPRIN2 (9721)
Length:
9421
CDS:
2605..4053

Additional Resources:

NCBI RefSeq record:
XM_017016974.2
NBCI Gene record:
GPRIN2 (9721)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016974.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244113 GCACATCTCTCACCTGAATAT pLKO_005 4156 3UTR 100% 13.200 9.240 N GPRIN2 n/a
2 TRCN0000244112 CATGACCTCAGCCAATGACTT pLKO_005 3621 CDS 100% 4.950 3.465 N GPRIN2 n/a
3 TRCN0000244114 CTATGCAGAGGAGCCATTCAG pLKO_005 3023 CDS 100% 4.950 3.465 N GPRIN2 n/a
4 TRCN0000244111 AGATCCACTGTAGGTTGTCTG pLKO_005 3506 CDS 100% 4.050 2.835 N GPRIN2 n/a
5 TRCN0000181028 CTTGATTTCCAAGGGCCACAT pLKO.1 4249 3UTR 100% 4.050 2.835 N GPRIN2 n/a
6 TRCN0000180368 GACCAAAGATGTGTGGACCAT pLKO.1 3603 CDS 100% 2.640 1.848 N GPRIN2 n/a
7 TRCN0000244115 CCTGAGGATGAGACTTCTAAC pLKO_005 3208 CDS 100% 10.800 6.480 N GPRIN2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 8810 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016974.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.