Transcript: Human XM_017017192.2

PREDICTED: Homo sapiens cytochrome P450 family 2 subfamily R member 1 (CYP2R1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYP2R1 (120227)
Length:
2223
CDS:
946..2106

Additional Resources:

NCBI RefSeq record:
XM_017017192.2
NBCI Gene record:
CYP2R1 (120227)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017192.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215969 CATGGCCCTTTATCCTAATAT pLKO.1 1575 CDS 100% 15.000 21.000 N Cyp2r1 n/a
2 TRCN0000416463 AGCCTTCTTGGGACGACAAAT pLKO_005 1646 CDS 100% 13.200 18.480 N CYP2R1 n/a
3 TRCN0000433611 TGGGTTGATCACAGACGATTA pLKO_005 997 CDS 100% 10.800 15.120 N CYP2R1 n/a
4 TRCN0000064500 CGTGGTTATTCCATTCCTAAA pLKO.1 1768 CDS 100% 10.800 8.640 N CYP2R1 n/a
5 TRCN0000194000 GTTTAGATCTTGGAGGCATAT pLKO.1 833 5UTR 100% 10.800 7.560 N Cyp2r1 n/a
6 TRCN0000173520 GAGGCTTACTCAATTCCAGAT pLKO.1 965 CDS 100% 4.050 2.835 N Cyp2r1 n/a
7 TRCN0000064498 GCCTTGTTCATCAAAGCGAAA pLKO.1 893 5UTR 100% 4.050 2.835 N CYP2R1 n/a
8 TRCN0000064502 CCCATCATCTACTTTCTCCAA pLKO.1 1470 CDS 100% 2.640 1.848 N CYP2R1 n/a
9 TRCN0000064501 GCCTCAGTCTTCTTGTATAAT pLKO.1 1270 CDS 100% 15.000 9.000 N CYP2R1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017192.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.