Transcript: Human XM_017017379.1

PREDICTED: Homo sapiens centrosomal protein 164 (CEP164), transcript variant X23, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP164 (22897)
Length:
5959
CDS:
419..4861

Additional Resources:

NCBI RefSeq record:
XM_017017379.1
NBCI Gene record:
CEP164 (22897)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017379.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149955 GCTCCGAGAAATTCTTGATGA pLKO.1 3466 CDS 100% 4.950 6.930 N CEP164 n/a
2 TRCN0000449371 CTAAGGCCAGAGAGCAGTATG pLKO_005 3066 CDS 100% 10.800 8.640 N CEP164 n/a
3 TRCN0000443873 TTACCTCTCTTCTCGTCAACA pLKO_005 4763 CDS 100% 4.950 3.960 N CEP164 n/a
4 TRCN0000127595 CCAGCCAAGAACTGGAAATTA pLKO.1 1563 CDS 100% 15.000 10.500 N CEP164 n/a
5 TRCN0000258105 TGGAGAAGTGGCGCAAGTATT pLKO_005 4548 CDS 100% 13.200 9.240 N Cep164 n/a
6 TRCN0000449839 TGCTCTTCGTGGATCTCAAAG pLKO_005 895 CDS 100% 10.800 7.560 N CEP164 n/a
7 TRCN0000147245 GCAGTGAAAGTTCTGAATCTT pLKO.1 4167 CDS 100% 5.625 3.938 N CEP164 n/a
8 TRCN0000147376 GCATTGTTTCCATCTGTCTTT pLKO.1 5693 3UTR 100% 4.950 3.465 N CEP164 n/a
9 TRCN0000148591 CAGGATTTAGAGTTGGACCTT pLKO.1 3251 CDS 100% 2.640 1.848 N CEP164 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017379.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.