Transcript: Human XM_017017421.1

PREDICTED: Homo sapiens Rho guanine nucleotide exchange factor 12 (ARHGEF12), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGEF12 (23365)
Length:
9143
CDS:
861..5186

Additional Resources:

NCBI RefSeq record:
XM_017017421.1
NBCI Gene record:
ARHGEF12 (23365)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047478 CGTCGCATCTTCCTTGAGTTT pLKO.1 1806 CDS 100% 4.950 6.930 N ARHGEF12 n/a
2 TRCN0000298872 CGTCGCATCTTCCTTGAGTTT pLKO_005 1806 CDS 100% 4.950 6.930 N ARHGEF12 n/a
3 TRCN0000047480 GCGTTGCGTAATCATCCAGAA pLKO.1 761 5UTR 100% 4.050 5.670 N ARHGEF12 n/a
4 TRCN0000298942 GCGTTGCGTAATCATCCAGAA pLKO_005 761 5UTR 100% 4.050 5.670 N ARHGEF12 n/a
5 TRCN0000047481 CCAGAAGTTCAAAGGCACTTA pLKO.1 1971 CDS 100% 4.950 3.465 N ARHGEF12 n/a
6 TRCN0000298870 CCAGAAGTTCAAAGGCACTTA pLKO_005 1971 CDS 100% 4.950 3.465 N ARHGEF12 n/a
7 TRCN0000047482 GCGAGTATCCAGAGAAGGAAT pLKO.1 2996 CDS 100% 4.950 3.465 N ARHGEF12 n/a
8 TRCN0000298941 GCGAGTATCCAGAGAAGGAAT pLKO_005 2996 CDS 100% 4.950 3.465 N ARHGEF12 n/a
9 TRCN0000047479 CCACTCAAATGCAAAGGCTTA pLKO.1 3343 CDS 100% 4.050 2.835 N ARHGEF12 n/a
10 TRCN0000298869 CCACTCAAATGCAAAGGCTTA pLKO_005 3343 CDS 100% 4.050 2.835 N ARHGEF12 n/a
11 TRCN0000109963 CCTCAGTCTCATTCACTGAAT pLKO.1 4125 CDS 100% 0.495 0.347 N Arhgef12 n/a
12 TRCN0000326911 CCTCAGTCTCATTCACTGAAT pLKO_005 4125 CDS 100% 0.495 0.347 N Arhgef12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.