Transcript: Human XM_017017455.2

PREDICTED: Homo sapiens RAB38, member RAS oncogene family (RAB38), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB38 (23682)
Length:
3321
CDS:
121..654

Additional Resources:

NCBI RefSeq record:
XM_017017455.2
NBCI Gene record:
RAB38 (23682)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382464 GGATATCGCAGGTCAAGAAAG pLKO_005 312 CDS 100% 10.800 15.120 N RAB38 n/a
2 TRCN0000381152 CCCTAATGGCAAACCGGTTTC pLKO_005 462 CDS 100% 6.000 8.400 N RAB38 n/a
3 TRCN0000293706 GAAACATGACGAGGGTCTATT pLKO_005 338 CDS 100% 13.200 9.240 N RAB38 n/a
4 TRCN0000048183 CGAGAAGCTATGGGTGCATTT pLKO.1 361 CDS 100% 10.800 7.560 N RAB38 n/a
5 TRCN0000293707 TGATTTGGACTCCAAGTTAAG pLKO_005 438 CDS 100% 10.800 7.560 N RAB38 n/a
6 TRCN0000048186 GTTTCGTAGGATGGTTTGAAA pLKO.1 572 CDS 100% 5.625 3.938 N RAB38 n/a
7 TRCN0000311757 GTTTCGTAGGATGGTTTGAAA pLKO_005 572 CDS 100% 5.625 3.938 N RAB38 n/a
8 TRCN0000048184 GCTCATGAACAATGGCCTCAA pLKO.1 525 CDS 100% 4.050 2.430 N RAB38 n/a
9 TRCN0000286334 GCTCATGAACAATGGCCTCAA pLKO_005 525 CDS 100% 4.050 2.430 N RAB38 n/a
10 TRCN0000048185 GCAAACCGGTTTCAGTGGTTT pLKO.1 470 CDS 100% 0.495 0.297 N RAB38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.