Transcript: Human XM_017017513.1

PREDICTED: Homo sapiens C2 domain containing 3 centriole elongation regulator (C2CD3), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C2CD3 (26005)
Length:
5952
CDS:
117..5285

Additional Resources:

NCBI RefSeq record:
XM_017017513.1
NBCI Gene record:
C2CD3 (26005)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246006 TACGCCAGCCTCCCATAATTT pLKO_005 572 CDS 100% 15.000 21.000 N C2CD3 n/a
2 TRCN0000183333 GCCTAAGGAATCTGTAAACAA pLKO.1 2582 CDS 100% 5.625 7.875 N C2CD3 n/a
3 TRCN0000246010 AGGTAACCATGGAGCTTATTA pLKO_005 307 CDS 100% 15.000 10.500 N C2CD3 n/a
4 TRCN0000246009 ATCTGGTGCAGATACTATTAT pLKO_005 1557 CDS 100% 15.000 10.500 N C2CD3 n/a
5 TRCN0000246007 TAAGTGGCAACACCCATTATA pLKO_005 364 CDS 100% 15.000 10.500 N C2CD3 n/a
6 TRCN0000181030 CCGATGAGTCATCTCCTGTAT pLKO.1 3235 CDS 100% 4.950 3.465 N C2CD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.