Transcript: Human XM_017017526.1

PREDICTED: Homo sapiens teneurin transmembrane protein 4 (TENM4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TENM4 (26011)
Length:
14724
CDS:
1640..9949

Additional Resources:

NCBI RefSeq record:
XM_017017526.1
NBCI Gene record:
TENM4 (26011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247679 CCTGGTTCATCCGCCTAATTA pLKO_005 11565 3UTR 100% 15.000 21.000 N TENM4 n/a
2 TRCN0000247677 CAGATCAACACAGTACTTAAT pLKO_005 9590 CDS 100% 13.200 18.480 N TENM4 n/a
3 TRCN0000344151 GATGACCGTCCAGTATGATAA pLKO_005 8134 CDS 100% 13.200 18.480 N TENM4 n/a
4 TRCN0000344207 TGCGGGTTCACAACCGAAATC pLKO_005 7131 CDS 100% 10.800 15.120 N TENM4 n/a
5 TRCN0000422936 CTATCTGGATAGGGTAGTTAA pLKO_005 4009 CDS 100% 13.200 9.240 N Tenm4 n/a
6 TRCN0000247678 TGAATCCTGCCCAGATCTAAT pLKO_005 5065 CDS 100% 13.200 9.240 N TENM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.