Transcript: Human XM_017017550.1

PREDICTED: Homo sapiens beta-1,3-glucuronyltransferase 1 (B3GAT1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
B3GAT1 (27087)
Length:
2231
CDS:
150..1154

Additional Resources:

NCBI RefSeq record:
XM_017017550.1
NBCI Gene record:
B3GAT1 (27087)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017550.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152693 GCAATAGACATGGCTGGATTT pLKO.1 903 CDS 100% 10.800 8.640 N B3GAT1 n/a
2 TRCN0000153981 CCATTTGCAATAGACATGGCT pLKO.1 897 CDS 100% 0.750 0.525 N B3GAT1 n/a
3 TRCN0000269045 ACGCTGCTGCACGTGCCCATC pLKO_005 471 CDS 100% 0.000 0.000 Y Fam229a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017550.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.