Transcript: Human XM_017018202.1

PREDICTED: Homo sapiens ATP binding cassette subfamily C member 8 (ABCC8), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCC8 (6833)
Length:
4785
CDS:
1368..4679

Additional Resources:

NCBI RefSeq record:
XM_017018202.1
NBCI Gene record:
ABCC8 (6833)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018202.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059859 CAACGGTACAAGATGGTCATT pLKO.1 2319 CDS 100% 4.950 6.930 N ABCC8 n/a
2 TRCN0000059860 CGTGGTCTACTATCACAACAT pLKO.1 210 5UTR 100% 4.950 6.930 N ABCC8 n/a
3 TRCN0000428448 TCGGAGTCAGTGCCTTAATTG pLKO_005 1217 5UTR 100% 13.200 10.560 N ABCC8 n/a
4 TRCN0000433881 AGCAATACAGACCAAGATTTA pLKO_005 1017 5UTR 100% 13.200 9.240 N ABCC8 n/a
5 TRCN0000059862 GTGCCATCCTTGAGTTCGATA pLKO.1 4594 CDS 100% 4.950 3.465 N ABCC8 n/a
6 TRCN0000059861 CGTGTGCTACTTCATCCAGAA pLKO.1 3449 CDS 100% 4.050 2.835 N ABCC8 n/a
7 TRCN0000059858 GCACATCATCATTGATGGCAT pLKO.1 4133 CDS 100% 0.264 0.158 N ABCC8 n/a
8 TRCN0000102996 CCTTCGTGAATCTGCTGTCAA pLKO.1 509 5UTR 100% 4.950 3.465 N Abcc8 n/a
9 TRCN0000093081 GATGAGGAAGAGGAGGAAGAA pLKO.1 2835 CDS 100% 4.950 2.475 Y Gm5518 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018202.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.