Transcript: Human XM_017018327.1

PREDICTED: Homo sapiens glutamine and serine rich 1 (QSER1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
QSER1 (79832)
Length:
6041
CDS:
301..5967

Additional Resources:

NCBI RefSeq record:
XM_017018327.1
NBCI Gene record:
QSER1 (79832)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018327.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135716 GCTCCTGTTGATAGTACATTA pLKO.1 3664 CDS 100% 13.200 18.480 N QSER1 n/a
2 TRCN0000135671 GCGTGATGAATTTGTGGTAAA pLKO.1 4755 CDS 100% 10.800 15.120 N QSER1 n/a
3 TRCN0000135886 GCATGCTAAATGATAACCGAA pLKO.1 5444 CDS 100% 2.640 3.696 N QSER1 n/a
4 TRCN0000429119 CACATAATGTGCCATCTATTG pLKO_005 1733 CDS 100% 10.800 8.640 N QSER1 n/a
5 TRCN0000413259 AGCACTCCTTACATAGTTATC pLKO_005 1313 CDS 100% 10.800 7.560 N QSER1 n/a
6 TRCN0000137511 GCCTTAGAGAAGAGCAATGAT pLKO.1 5389 CDS 100% 5.625 3.938 N QSER1 n/a
7 TRCN0000135824 CCCTTGATCTTAAGAACTCAA pLKO.1 2648 CDS 100% 4.950 3.465 N QSER1 n/a
8 TRCN0000138071 GCTGTTTGCTACTGGACCTTT pLKO.1 810 CDS 100% 4.950 3.465 N QSER1 n/a
9 TRCN0000137785 GCAAGCCTTAGAGAAGAGCAA pLKO.1 5385 CDS 100% 2.640 1.848 N QSER1 n/a
10 TRCN0000137956 GCACAAGAGTTTGCTGTCGAT pLKO.1 5653 CDS 100% 2.640 1.848 N QSER1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018327.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.