Transcript: Human XM_017018380.1

PREDICTED: Homo sapiens kinesin family member 18A (KIF18A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF18A (81930)
Length:
2150
CDS:
223..1587

Additional Resources:

NCBI RefSeq record:
XM_017018380.1
NBCI Gene record:
KIF18A (81930)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018380.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117074 GCAGACGTAAATTCTGGATTT pLKO.1 1420 CDS 100% 10.800 15.120 N KIF18A n/a
2 TRCN0000117072 CCCATCTTAAAGCTAAGTTTA pLKO.1 1685 3UTR 100% 13.200 10.560 N KIF18A n/a
3 TRCN0000117076 GCTCAATGATTCTCTTAGCAA pLKO.1 963 CDS 100% 3.000 2.400 N KIF18A n/a
4 TRCN0000426193 GAAAGCACAAATTAGACATAT pLKO_005 534 CDS 100% 13.200 9.240 N KIF18A n/a
5 TRCN0000417075 GAAAGGACAGCATACTCTAAA pLKO_005 918 CDS 100% 13.200 9.240 N KIF18A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018380.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.