Transcript: Human XM_017018459.2

PREDICTED: Homo sapiens carbohydrate sulfotransferase 1 (CHST1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHST1 (8534)
Length:
2120
CDS:
707..2005

Additional Resources:

NCBI RefSeq record:
XM_017018459.2
NBCI Gene record:
CHST1 (8534)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034682 AGACCCGCGATTAAACCTCAA pLKO.1 1369 CDS 100% 4.050 5.670 N CHST1 n/a
2 TRCN0000437251 CAAATACGGCACCGTGCGAAA pLKO_005 1741 CDS 100% 4.050 5.670 N CHST1 n/a
3 TRCN0000034680 CAAGTACATGTTGGTGCGCTA pLKO.1 1591 CDS 100% 2.160 3.024 N CHST1 n/a
4 TRCN0000034681 CCTCTACGACTGCGACCTCTA pLKO.1 1084 CDS 100% 1.350 1.890 N CHST1 n/a
5 TRCN0000034683 CCACGTCCAGAACACGCTCAT pLKO.1 988 CDS 100% 1.350 1.080 N CHST1 n/a
6 TRCN0000034679 CTGGACGTCTTCTACCTGTTT pLKO.1 956 CDS 100% 4.950 2.970 N CHST1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.